martes, 21 de junio de 2011

Enter the Dragon (1973)





Operación Dragón - Robert Clouse (1973)





Las ganas que tenia de ver esta peli, neta, si me quemaba por verla, es de las que me faltaban en mi colección y siempre se escucha una referencia a esta historia, según me dicen, es de las mejores de Bruce Lee y es una de las más conocidas, hasta se puede decir que es con la que se inicio el culto por el cine de kung fu.


Esta es la ultima pelicula de Bruce Lee, pues él muere una semana antes de su estreno en Hong Kong, a de ser bien chingón que tu personaje lleve tu nombre ;D

Aquí vemos a un monje shaolin al que se le invita a participar en un concurso de artes marciales, organizado por un criminal al que no le han podido comprobar nada, se le acusa de trato de blancas y narcotrafico, entonces Lee tiene que ir a reunir las pruebas para poder hacer algo al respecto en una isla junto con otros de los mejores peleadores del mundo.

Una de esas lineas si se repite a lo largo de la historia "un concurso de artes marciales" hahaha eso si esta desde Mortal Kombat, hasta en series y mil pelis más... ¿Que pedo con los gritos de los karatecas? nunca entendi por que los golpes suenan a madrazo de carnicero al aplastar los bisteces, ni por que se tiene que gritar como gato atorado al hacer un movimiento, ya sabes el; auuuuuuuuuuggggggggggaaaaaaaaauuuuuuuuiiiiiiiieeeeee!!!

Algo que si es muy neta es que de esta peli sacaron muchos posters del prota, que vemos en cualquier gimnasio y en todos los tianguis donde ventan litografias, hahaha eso si me consta, pero ahora me quedo con la duda de saber cual es la peli donde sale con el traje amarillo, aquel que utilizo Uma Thurman en Kill Bill... averiguemoslo...


Pues ahí esta la recomendación, esta entretenida la peli, y si creo que entra en la de "para que no te cuenten", es considerada la primer peli de alto presupuesto por un estudio grande donde se empleen artes marciales y forma parte de la colección en reserva de la National Film Registry, ahí tienes otra recomendación a menos de que quieras ver si ya va a iniciar Iniciativa México... pero ese es tu pedo.







Yobailopogo!
-el enemigo solo tiene imágenes e ilusiones-




.

12 comentarios:

David C. dijo...

Tienes todo un estilo para contar las películas. Saludos.

Antony Sampayo dijo...

Me trajo nostalgia mirar tu post. De niño vi muchas películas de este extraordinario actor. Buena remembranza.

Saludos.

la MaLquEridA dijo...

Tengo un hermano al que le gustaba mucho Bruce Lee gracias a él vi esa película.



Un abrazo reptilio.

Carla Fernanda dijo...

Uma boa dica Reptilio. Obrigada!!
Gosto de filme com monges.
Beijos!!!!
Carla

I´m Zilly dijo...

Mi papá es bieeeen fan de Bruce Lee y de ahí la conozco... chingonada de película
:D
Saludos!!

reptilio dijo...

David C: Gracias men, ojala te guste como contamos las pelis acá ;D

Antony Sampayo: Pues yo nunca la habia visto, y por fin se me hizo, voy a aprovechar y ver una que tampoco me la vas a creer que se supone que es de las que "ya todos vieron" ;D

la MaLquEridA: que chido, yo igual por mis carnales he visto varias cosas que no conocia

Carla Fernanda: besitos carla hahaha a la playa ya

I´m Zilly: si esta chida y me quede con ganas de ver mas de él, ahi si tu papa nos quiere recomendar unas adelante :D preguntale cuales son las chidas



buen dia a todos ybp!

Gerardo dijo...

¡waaaaaasaaaaaaooooouuuuiiiiaaaa!

esta peli es la neta del planeta, de culto 100% ... el actor de color se llama Jim Kelly
y esta cinta lo hizo famoso, también sale Bolo Yeung, Chong Li en "Bloodsport",
men, hay otra película de Bruce Lee que me parece es la última e incluso quedó incompleta,
solo hay como media hora de filmación y es "Game of Death" ahí sale con los pants amarillos
peleando con Kareem Abdul Jabbar

chécate estos videos, ahi lo explican: Everything is a Remix 1,2,3

parte 1: http://vimeo.com/14912890

p.d

ya no tengo blog pero dejé la cuenta para seguir comentando, luego les cuento bien el chisme

saludos

Gerardo dijo...

y este es el video de los pants amarillos con hartas escenas de pelis de Kung Fu

http://vimeo.com/19469447

reptilio dijo...

Gerardo: carnal! si veo que la libreta luego si anda luego no, luego solo para invitados, chingon por darte tu vuelta por aca y complementar las entradas...

Me gusto un buen Everything is a Remix 1,2,3 ahora a esperar el 4

Un detalle por ahi, ojala me pudieras mandar la imagen que tenias de banner del adivina el filme para ponerlo en el otro blog, pues nada champion, espero que andes bien y lo q te tenga ocupado sean cosas buenas

Suerte!

Gerardo dijo...

aquí esta el banner para el blog, es el tamaño original, yo lo tenía reducido a 197 X 148

http://img71.xooimage.com/files/5/6/c/marquesina-2a1fdbf.jpg

saludos

Karlita la + Bonita dijo...

esta es de las que le gustan a mi mamá, jajaja, antes veía muchas de este tipo con ella (más a fuerza que de ganas XD), pero no podría diferir entre una y otra ni acordarme de los titulos!

reptilio dijo...

Gerardo: Listo men ya lo puse en el adivina! hahaha (por cierto creo que me lo voy a llevar de nuevo este mes) yeah!

Karlita la + Bonita: jajaja a mi mama le laten de terror hahaha

ybp!